CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES ›› 2024, Vol. 42 ›› Issue (2): 169-176.doi: 10.12140/j.issn.1000-7423.2024.02.006
• ORIGINAL ARTICLES • Previous Articles Next Articles
TAN Nie1(
), JIAO Shiming1,2, DING Yan1, ZHU Chengyu2, XU Wenyue1,2,*(
)
Received:2023-11-01
Revised:2023-12-26
Online:2024-04-30
Published:2024-04-26
Contact:
* E-mail: Supported by:CLC Number:
TAN Nie, JIAO Shiming, DING Yan, ZHU Chengyu, XU Wenyue. Effect of local complement activation in hepatocytes on the development of Plasmodium in the infrared phase[J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2024, 42(2): 169-176.
Add to citation manager EndNote|Ris|BibTeX
URL: https://www.jsczz.cn/EN/10.12140/j.issn.1000-7423.2024.02.006
Table 1
PCR amplification primer sequences for complement C3, C5 and their receptor genes
| 来源 Source | 基因Gene | 引物序列(5'→3') Primer sequence (5'→3') |
|---|---|---|
| 小鼠 Mus musculus | C3 | F:CACACCGAAGAAGACTGCCTGAC R:CTGACTTGATGACCTGCTGGATGG |
| C3aR1 | F:TCTCCTTGGCTCACCTGATTCTCC R:AGGCTACCACCCAGACACATCC | |
| C5 | F:TACAAGCCCAGCAAGGAGGAGTC R:AGGCTACCACCCAGACACATCC | |
| C5aR1 | F:TCTACTCGGTGGTGTTCCTGGTG R:AAGGATGGAATGGTGAGGAGCAATG | |
| 人 Homo sapiens | C3 | F:GTCACTGTTACTGTCCACGACTTCC R:GCACCACCTTCTCCACCACTTG |
| C3aR1 | F:GCAGCGGACAGTGAACACAATTTG R:CACAAGCCACCACCCAGATACATC | |
| C5 | F:TTCAACCCAGGACACCATCAATGC R:TGTAGCCAAGCCACTGCCAAATC | |
| C5aR1 | F:AAGCGGACCATCAATGCCATCTG R:TCCACGCCACACAACACCTTTG |
Fig. 2
Laser confocal microscope observation of hepatocyte local complement enrichment around parasitophorous vacuole (Indirect immunofluorescence staining, × 2 500) A: The expression of C3a around the parasitophorous vacuole. B: The expression of C5a around the parasitophorous vacuole. C: The expression of C5aR on the parasitophorous vacuole membrane. D: The expression of C5aR on the parasitophorous vacuole membrane after incubating with C5aR antagonist. The nucleus shows blue fluorescence by DAPI; P. yoelii exprsses RFP in infrared phase, showing red spontaneous fluorescence; C3a, C5a shows green fluorescence inside hepatocytes; C5aR enriches on the vacuolar membrane of nanoworms, exhibiting pink fluorescence; UIS4 shows green fluorescence on the vacuolar membrane of the nanoworm; Merge means merge images.
Fig. 3
The effects of knocking out different complements on the liver parasites infrared and phase development of Plasmodium A: Liver parasites of mice infected with P. yoelii in the control group, CVF group and C3-/- group; B: Appearance time of the red phase after attacking the control group and C3aR-/- mice with P. yoelii; C: Appearance time of the red phase after attacking the control group and C5aR-/- mice with P. berghei; D: The appearance time of the red phase after P. yoelii attacked Alb-cre+/+C5aRflox/flox hybrid mice and C5aR-/- mice. a: P > 0.05.
|
| [1] | WANG Zhenyu, JIANG Li, YU Qing, ZHANG Yaoguang, WU Huanyu, CHEN Jian, ZHU Min. Interpretation of the Criteria for Detection of Malaria Parasite Nucleic Acid by Multiplex PCR Methods [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2024, 42(4): 521-524. |
| [2] | WANG Rong, XU Jie, ZHU Xiaotong. Research advances on transmission-blocking vaccines targeting Plasmodium sexual stage [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2024, 42(3): 399-406. |
| [3] | HAN Zhuxi, ZHU Xiaotong. Research progress on Plasmodium membrane protein complexes [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2024, 42(1): 111-116. |
| [4] | GUO Shuai, HE Biao, GAO Yuanli, FAN Yongling, ZHU Feng, DING Yan, LIU Taiping, XU Wenyue. Specie-specific analysis of plasmodia infecting rats and mice [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2023, 41(5): 539-545. |
| [5] | LIANG Kejia, LIU Cong, LI Yanlin, LI Xiaoge, LIU Yan, LI Zhenkui. Research advances on transcriptional regulation in plasmodium sexual stages [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2023, 41(5): 619-624. |
| [6] | SUN Jun. The biological significance of malarial hemozoin’s formation [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2023, 41(2): 209-212. |
| [7] | GE Jie-yun, LIU Lei, SUN Yi-fan, CHENG Yang. Advances in research on the vacuolar membrane function and the associated proteins of plasmodium parasitophorous vacuole [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2022, 40(3): 402-410. |
| [8] | LU Fei, ZHUO Xun-hui, LU Shao-hong. Research progress on the interaction between host cell autophagy and apicomplexa protozoa infection [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2021, 39(6): 826-831. |
| [9] | LI Mei, TU Hong, XIA Zhi-gui, WANG Zhen-yu, ZHOU He-jun. Thermal stability of diagnostic targets Plasmodium falciparum histidine rich protein Ⅱ and Plasmodium lactate dehydrogenase in rapid detection [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2021, 39(2): 245-248. |
| [10] | LIU Hong, LIU Yao-bao, CAO Jun. Research advance and application of whole-genome sequencing of Plasmodium [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2021, 39(2): 265-270. |
| [11] | LUO Fei, TAN Yan, ZHOU Shuang, YUAN Yi, LI Shan-shan, XU Jing-ru, ZHOU Yang. Assessment and analysis of malaria diagnostic capacity by microscopy at primary health institutions in Chongqing [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2021, 39(1): 93-99. |
| [12] | ZHU Ling-qian, FENG Xin-yu, HU Wei, LI Shi-zhu. Functions and roles of miRNA during the infection of Anopheles by Plasmodium [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2020, 38(6): 742-748. |
| [13] | ZHOU Shui-mao, TU Zu-wu, YANG Yan, CHEN Fang, JIA Xi-shuai. Evaluation of the efficacy of loop-mediated isothermal amplification in detecting Plasmodium falciparum and other species of Plasmodium [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2020, 38(4): 423-428. |
| [14] | ZHANG Yan, XU Ai-fang, ZHANG Jia-qi, YAO Li-nong, GU Kai-long, XUE Li-zhi, PAN Ke-nv. Differential diagnosis of a case of Babesia microti infection previously misdiagnosed as malaria [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2020, 38(4): 445-448. |
| [15] | Wen-qi ZHENG, Xue-min FENG, Ya-ming CAO, Yan-qiu HAN, Jun-rui WANG. Bioinformatics analysis and enzymatic activity test of quiescin sulfhydryl oxidase from Plasmodium berghei [J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2020, 38(2): 159-165. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||