Echinococcus granulosus infection induces macrophages to express CD73 and A2AR to suppress inflammatory response

doi:10.12140/j.issn.1000-7423.2023.05.006

Abstract

Abstract:

Objective To investigate the role and mechanisms of CD73/adenosine/adenosine A2A receptor (A2AR) pathway in suppression of macrophage inflammatory response of Echinococcus granulosus. Methods Healthy C57BL/6 mice were intraperitoneally injected with aseptic starch broth (0.5 ml per mouse). Ascitic fluid was extracted from the mice on 3 d post-injection to separate macrophages, which were inoculated into a 6-well plate at a dose of 1 × 10⁶/ml. After the cells were attached to the plate wall, E. granulosus cyst fluid was added at a final concentration of 0.8 mg/ml, and then cultured for 0 h, 6 h, 12 h, 18 h and 24 h to examine the relative transcriptional levels of CD73, A2AR, tumor necrosis factor-α (TNF-α) and arginase 1 (Arg-1) by qRT-PCR. The expression of CD73 was detected by flow cytometry, and the expression of extracellular signal-regulated kinase 1 (ERK1/2) and phosphorylated ERK1/2 (p-ERK1/2) was detected by Western blotting. The separated macrophages were inoculated onto a 6-well plate with 1 × 10⁶ cells per well, and assigned to three groups: cyst fluid group, drug administration group and control group. Each group had 3 wells, to which E. granulosus cyst fluid (final concentration 0.8 mg/ml), E. granulosus cyst fluid (final concentration 0.8 mg/ml) and drugs (adenosine receptor inhibitor SCH58261, final concentration 50 μmol/L) and the same amount of medium was added, respectively. After 24 hours of culture, the relative transcription levels of TNF-α and Arg-1 were detected by qRT-PCR. The expression of ERK1/2 and p-ERK1/2 was detected by Western blotting. Thirty-six healthy C57BL/6 female mice aged 6-8 weeks were selected. 5 000 protoscolex of E. granulosus (20 μl per mouse) were injected under the liver capsule in the infection group, and the healthy group were not treated. One month later, the livers of 6 mice in each group were selected and embedded in paraffin to prepare slices. HE staining was used to observe liver tissue lesions, and the expression of A2AR was detected by immunohistochemical staining. The expression of CD73 in the proximal and distal vesicles was detected by flow cytometry. Infected mice were taken, and 1 mg/(kg•d) adenosine receptor inhibitor (SCH58261) and an equivalent amount of PBS were intraperitoneally injected into the treatment group (8 mice) and solvent group (8 mice), respectively. Healthy mice (8 mice) were not treated. After 22 days, the mice’s weight, liver, spleen, kidney and heart were weighed, and the ratio of each organ to body weight was calculated. After the mouse liver was embedded in paraffin, the sections were prepared, and the infiltration of inflammatory cells around the vesicles was observed by HE staining. Results The relative transcription level of CD73 mRNA in 18 h group (1.66 ± 0.17) and 24 h group (2.01 ± 0.15) was higher than that in 0 h group (1.00 ± 0.09) after 0 h, 6 h, 12 h, 18 h and 24 h treatment of macrophages with E. granulosus cyst solution (t = 3.35, P < 0.05; t = 5.83, P < 0.01). Flow cytometry showed that the percentage of CD73⁺ macrophages in 18 h group was (2.74 ± 0.43)%, which was higher than that in 0 h group (1.53 ± 0.10)% (t = 4.72, P < 0.01). The relative transcription levels of A2AR mRNA were 0.29 ± 0.03, 1.00 ± 0.14, 1.02 ± 0.02, 0.72 ± 0.08, 1.03 ± 0.03, respectively. All groups at 6 h, 12 h, 18 h and 24 h were higher than those in 0 h group (t = 4.84, 17.55, 5.21, 15.26; all P < 0.01). The western blotting results showed that the relative expression levels of A2AR protein in each group were 1.00 ± 0.00, 1.22 ± 0.05, 1.32 ± 0.02, 1.40 ± 0.05, and 1.46 ± 0.04, respectively. The relative expression levels of other groups were higher (t = 5.89, 18.35, 9.14, 15.06; all P < 0.01). Western blotting showed that the relative expression levels of A2AR protein in 6, 12, 18 and 24 h groups were 1.22 ± 0.05, 1.32 ± 0.02, 1.40 ± 0.05, and 1.46 ± 0.04，0.04, respectively. All of them were higher than those in the 0 h group (1.00 ± 0.00) (t = 5.89, 18.35, 9.14, 15.06; all P < 0.01). The relative transcription levels of TNF-α mRNA in the 6, 12 and 18 h groups were 1.00 ± 0.04, 0.31 ± 0.03, 0.12 ± 0.01, 0.05 ± 0.01, respectively, which were higher than those in the 0 h group (0.01 ± 0.00) (t = 22.37, 11.33, 11.48; all P < 0.01). The relative transcription level of Arg-1 mRNA in 18 h group (0.69 ± 0.09) and 24 h group (2.10 ± 0.07) was higher than that in 0 h group (0.004 ± 0.00) (t = 7.61, 28.64; both P < 0.01). Western blotting results showed that the relative expression of p-ERK1/2 protein in the 6 h group (3.07 ± 0.71), 12 h group (1.68 ± 0.18) and 18 h group (1.43 ± 0.14) was higher than that in the 0 h group (1.00 ± 0.00) (t = 4.15, 5.40, 4.50; all P < 0.05). The 6 h group was higher than the 18 h and 24 h groups (0.97 ± 0.34) (t = 3.23, 3.80; both P < 0.05). The relative transcription levels of TNF-α mRNA were 0.85 ± 0.05 and 1.56 ± 0.13 in the capsule fluid group and administration group, respectively, and the difference was statistically significant (t = 5.13, P < 0.01). The relative transcription level of Arg-1 mRNA in the capsule fluid group was 147.73 ± 10.06, which was higher than that in the drug administration group (13.94 ± 1.00) (t = 13.23, P < 0.01) and control group (59.59 ± 9.82) (t = 6.27, P < 0.01). The relative transcription level in the administration group was lower than that in the control group, and the difference was statistically significant (t = 4.62, P < 0.01). Western blotting results showed that the relative protein expression of P-ERK1/2 in the administration group (2.08 ± 0.38) was higher than that in the capsule fluid group (0.94 ± 0.29) and control group (1.00 ± 0.00) (t = 3.42, 4.04; both P < 0.05). The HE staining showed that inflammatory cell infiltration zones appeared in the liver tissue of infected mice. The immunohistochemical staining results showed that A2AR was positive in the infection group. The results of flow cytometry showed that the percentage of macrophages with CD73⁺ in the proximal vesicle was (12.31 ± 0.04)%, which was higher than that at the distal vesicle (5.95 ± 2.36)% (t = 3.81, P < 0.05). After administration, the ratio of weight of liver, spleen, kidney and heart to body mass in the healthy group, solvent group and administration group was 6.13 ± 0.66, 5.90 ± 0.48, 5.47 ± 0.87, 0.44 ± 0.18, 0.41 ± 0.29, 0.33 ± 0.10. There was no significant difference between 0.68 ± 0.03, 0.64 ± 0.05, 0.60 ± 0.09, 0.99 ± 0.15, 0.77 ± 0.13, 0.78 ± 0.19 (F = 0.95, 0.42, 1.46, 2.02; all P > 0.05). HE staining showed that perivascular inflammatory cells increased in the drug administration group compared with the solvent group. Conclusion E. granulosus evades host immunity by inducing macrophages to express CD73 and A2AR and thereby promoting the secretion of its inflammatory inhibitory factors.

Key words: Echinococcus granulosus, Macrophages, CD73, Adenosine A2A receptor

CLC Number:

R383.3

LU Junxia, XU Junying, ZHAO Bin, WANG Qianwen, LI Wenhua, GENG Yuqing, HOU Jun, WU Xiangwei, CHEN Xueling. Echinococcus granulosus infection induces macrophages to express CD73 and A2AR to suppress inflammatory response[J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2023, 41(5): 559-566.

Figures/Tables 9

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

Fig. 8

References 22

[1]	Wen H, Vuitton L, Tuxun T, et al. Echinococcosis: advances in the 21st century[J]. Clin Microbiol Rev, 2019, 32(2): e00075.
[2]	Peters L, Burkert S, Grüner B. Parasites of the liver: epidemiology, diagnosis and clinical management in the European context[J]. J Hepatol, 2021, 75(1): 202-218.
[3]	Gottstein B, Soboslay P, Ortona E, et al. Immunology of alveolar and cystic echinococcosis (AE and CE)[J]. Adv Parasitol, 2017, 96: 1-54.
[4]	Siracusano A, Teggi A, Ortona E. Human cystic echinococcosis: old problems and new perspectives[J]. Interdiscip Perspect Infect Dis, 2009, 2009: 474368.
[5]	Li LF, Wang LP, Li JY, et al. Metformin-induced reduction of CD39 and CD73 blocks myeloid-derived suppressor cell activity in patients with ovarian cancer[J]. Cancer Res, 2018, 78(7): 1779-1791.
[6]	Antonioli L, Pacher P, Vizi ES, et al. CD39 and CD73 in immunity and inflammation[J]. Trends Mol Med, 2013, 19(6): 355-367.
[7]	Sun CF, Wang BC, Hao SL. Adenosine-A2A receptor pathway in cancer immunotherapy[J]. Front Immunol, 2022, 13: 837230.
[8]	Kazemi MH, Raoofi Mohseni S, Hojjat-Farsangi M, et al. Adenosine and adenosine receptors in the immunopathogenesis and treatment of cancer[J]. J Cell Physiol, 2018, 233(3): 2032-2057.
[9]	Antonioli L, Blandizzi C, Pacher P, et al. Immunity, inflammation and cancer: a leading role for adenosine[J]. Nat Rev Cancer, 2013, 13(12): 842-857.
[10]	Ghalamfarsa G, Kazemi MH, Raoofi Mohseni S, et al. CD73 as a potential opportunity for cancer immunotherapy[J]. Expert Opin Ther Targets, 2019, 23(2): 127-142.
[11]	Zeng JR, Ning ZC, Wang YZ, et al. Implications of CD39 in immune-related diseases[J]. Int Immunopharmacol, 2020, 89(Pt A): 107055.
[12]	Chen B, Yan MZ, Gao HJ, et al. In vitro and in vivo efficacies of novel harmine derivatives in the treatment of cystic echinococcosis[J]. Drug Des Devel Ther, 2023, 17: 2441-2454.
[13]	Wu JC, Zhu YQ, Zhou LM, et al. Parasite-derived excretory-secretory products alleviate gut microbiota dysbiosis and improve cognitive impairment induced by a high-fat diet[J]. Front Immunol, 2021, 12: 710513.
[14]	Xiao J, Zhu YZ, Wu JW, et al. Expression profiling of exosomal miRNAs derived from different stages of infection in mice infected with Echinococcus granulosus protoscoleces using high-throughput sequencing[J]. Parasitol Res, 2022, 121(7): 1993-2008.
[15]	Jayasingam SD, Citartan M, Thang TH, et al. Evaluating the polarization of tumor-associated macrophages into M1 and M2 phenotypes in human cancer tissue: technicalities and challenges in routine clinical practice[J]. Front Oncol, 2019, 9: 1512.
[16]	Skytthe MK, Graversen JH, Moestrup SK. Targeting of CD163⁺ macrophages in inflammatory and malignant diseases[J]. Int J Mol Sci, 2020, 21(15): 5497.
[17]	Ma SR, Deng WW, Liu JF, et al. Blockade of adenosine A2A receptor enhances CD8⁺ T cells response and decreases regulatory T cells in head and neck squamous cell carcinoma[J]. Mol Cancer, 2017, 16(1): 99.
[18]	Vincenzi F, Pasquini S, Contri C, et al. Pharmacology of adenosine receptors: recent advancements[J]. Biomolecules, 2023, 13(9): 1387.
[19]	Csóka B, Selmeczy Z, Koscsó B, et al. Adenosine promotes alternative macrophage activation via A2A and A2B receptors[J]. FASEB J, 2012, 26(1): 376-386.
[20]	Bach N, Winzer R, Tolosa E, et al. The clinical significance of CD73 in cancer[J]. Int J Mol Sci, 2023, 24(14): 11759.
[21]	Cai JN, Wang YL, Sheng XD, et al. Shufeng Jiedu capsule inhibits inflammation and apoptosis by activating A2AAR and inhibiting NF-κB to alleviate LPS-induced ALI[J]. J Ethnopharmacol, 2022, 298: 115661.
[22]	Wang LQ, Zhang WT, Cen RY, et al. ALA-PDT regulates macrophage M1 polarization via ERK/MAPK-NLRP3 pathway to promote the early inflammatory response[J]. Lasers Surg Med, 2022, 54(10): 1309-1320.

基因 Gene	引物序列（5'→3'） Sequence primer (5'→3')
CD73	F：CTCTGCACCAAGTGTCGAGT
	R：CTCCACCGTTGGCCAGATAG
A2A受体 A2AR	F：CTGCAGAACGTCACCAACTT
A2A受体 A2AR	R：GCGATGTATCTGTCGATGGC
肿瘤坏死因子α TNF-α	F：CCTGTAGCCCACGTCGTAG
肿瘤坏死因子α TNF-α	R：GGGAGTGAGCAAGGTACAACCC
精氨酸酶1 Arg-1	F：CTCCAAGCCAAAGTCCTTAGAG
精氨酸酶1 Arg-1	R：AGGAGCTGTCATTAGGGACATC
β-actin	F：GGCTATGCTCTCCCTCACG
β-actin	R：GAGCAACATAGCACAGCTTCTCTTT