Transcriptome analysis of splenic T follicular helper cells in mice infected with Schistosoma japonicum

doi:10.12140/j.issn.1000-7423.2026.02.005

Abstract

Abstract:

Objective To investigate the transcriptomics characteristics of splenic T follicular helper (Tfh) cells in mice infected with Schistosoma japonicum, and to screen and validate key differentially expressed genes (DEGs), so as to unravel the potential regulatory role of Tfh cells in the immune response to S. japonicum infection. Methods C57BL/6 mice were randomly divided into an infection group and a control group, of 8 mice each group. Mice in the infection group were infected with S. japonicum cercariae via skin contact, while animals in the control group received no treatment. Mouse spleens were sampled 6 weeks post-infection, and Tfh cells were isolated by gating based on the immune phenotype of positive cluster of differentiation 3, cluster of differentiation 4, CXC subfamily receptor 5, programmed death-1 (CD3⁺ CD4⁺ CXCR5⁺ PD-1⁺) by means of negative selection with magnetic beads and flow cytometry. Total RNA was extracted from cell samples with an RNA extraction kit and purified. Bulk RNA-seq sequencing was performed on the Illumina platform to screen DEGs [|log₂FoldChange| > 1 and P < 0.05], and DEGs were subjected to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, and screened DEGs were validated using reverse transcription quantitative Real-time PCR (RT-qPCR) assay. The expression of interleukin 5 (IL-5) and IL-13 proteins was measured using enzyme-linked immunosorbent assay (ELISA) in the serum of mice 2, 4, 6 and 8 weeks post-infection. Results Transcriptome sequencing identified a total of 1 379 DEGs, including 327 upregulated and 1 052 downregulated genes. GO and KEGG functional enrichment analyses revealed that these genes were significantly enriched in signal pathways of cytokine-cytokine receptor interaction, chemotaxis, and immune effector process regulation. RT-qPCR assay quantified higher relative il5 [(13.520 ± 1.540) vs. (1.060 ± 0.225); t = 10.52, P < 0.01] and il13 mRNA expression [(22.930 ± 0.720) vs. (1.137 ± 0.425); t = 28.41, P < 0.01] in the infection group than in the control group, and showed no significant difference between the infection and control groups in terms of relative neuromedin U receptor 1 (nmur1) [(11.210 ± 4.480) vs. (1.007 ± 0.084); t = 3.054, P > 0.05] or prostaglandin D2 receptor 2 (ptgdr2) mRNA expression [(4.405 ± 2.575) vs. (1.143 ± 0.443); t = 1.629, P > 0.05]. ELISA measured extremely low IL-5 (median, 2.00 pg/mL) and IL-13 concentrations (median, 4.00 pg/mL) in both uninfected mice and at early stages of infections (2 weeks post-infection). The median IL-13 concentration increased to 68.20 pg/mL at 4 weeks post-infection (P < 0.05), and the median IL-5 concentration rose to 77.06 pg/mL at 6 weeks post-infection (P < 0.05), which was maintained a high level in subsequent infection phases. Conclusion S. japonicum infection remarkably reshapes the transcriptome profile of murine splenic Tfh cells, leading to a highly activation state. Tfh cells may participate in maintaining the host Th2-type immune microenvironment and regulating immunopathology through significantly upregulating il5 and il13 expression.

Key words: Schistosoma japonicum, Follicular helper T cell, Transcriptome, Th2-type immunity

CLC Number:

R532.21

LI Jiajia, WANG Xi, QIU Jiayin, ZHOU Xinjie, LV Chao, WANG Weisi, QIN Zhiqiang. Transcriptome analysis of splenic T follicular helper cells in mice infected with Schistosoma japonicum[J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2026, 44(2): 182-188.

Figures/Tables 4

Table 1

Fig. 1

Fig. 2

Fig. 3

References 29

[1]	Zhou Y, Zheng M, Gong YF, et al. Changing seroprevalence of schistosomiasis japonica in China from 1982 to 2020: a systematic review and spatial analysis[J]. PLoS Negl Trop Dis, 2024, 18(9): e0012466.
[2]	Colley DG, Bustinduy AL, Secor WE, et al. Human schistosomiasis[J]. Lancet, 2014, 383(9936): 2253-2264.
[3]	Liu ZL, Zhang LC, Liang YM, et al. Pathology and molecular mechanisms of Schistosoma japonicum-associated liver fibrosis[J]. Front Cell Infect Microbiol, 2022, 12: 1035765.
[4]	Zheng B, Zhang JQ, Chen H, et al. T lymphocyte-mediated liver immunopathology of schistosomiasis[J]. Front Immunol, 2020, 11: 61.
[5]	Xiao JL, Guan F, Sun L, et al. B cells induced by Schistosoma japonicum infection display diverse regulatory phenotypes and modulate CD4⁺ T cell response[J]. Parasit Vectors, 2020, 13(1): 147.
[6]	Crotty S. T follicular helper cell biology: a decade of discovery and diseases[J]. Immunity, 2019, 50(5): 1132-1148.
[7]	Nurieva RI, Chung Y, Martinez GJ, et al. Bcl6 mediates the development of T follicular helper cells[J]. Science, 2009, 325(5943): 1001-1005.
[8]	Zotos D, Coquet JM, Zhang Y, et al. IL-21 regulates germinal center B cell differentiation and proliferation through a B cell-intrinsic mechanism[J]. J Exp Med, 2010, 207(2): 365-378.
[9]	Quast I, Dvorscek AR, Pattaroni C, et al. Interleukin-21, acting beyond the immunological synapse, independently controls T follicular helper and germinal center B cells[J]. Immunity, 2022, 55(8): 1414-1430.e5.
[10]	Zhao ZH, Xu BH, Wang S, et al. Tfh cells with NLRP3 inflammasome activation are essential for high-affinity antibody generation, germinal centre formation and autoimmunity[J]. Ann Rheum Dis, 2022, 81(7): 1006-1012.
[11]	Deng J, Wei YB, Fonseca VR, et al. T follicular helper cells and T follicular regulatory cells in rheumatic diseases[J]. Nat Rev Rheumatol, 2019, 15(8): 475-490.
[12]	Aoki N, Kido M, Iwamoto S, et al. Dysregulated generation of follicular helper T cells in the spleen triggers fatal autoimmune hepatitis in mice[J]. Gastroenterology, 2011, 140(4): 1322-1333.e5.
[13]	Bettelli E, Campbell DJ. Circulating TFH cells as a marker for early therapeutic intervention in T1D[J]. Nat Immunol, 2020, 21(10): 1141-1142.
[14]	Liang HB, Tang JY, Liu ZH, et al. ZIKV infection induces robust Th1-like Tfh cell and long-term protective antibody responses in immunocompetent mice[J]. Nat Commun, 2019, 10: 3859.
[15]	Siu JHY, Coelho S, Palomeras A, et al. Early lymph node T follicular helper cell signalling hub drives influenza vaccine response in an ancestrally diverse cohort[J]. EBioMedicine, 2025, 122: 106036.
[16]	Arroyo EN, Pepper M. B cells are sufficient to prime the dominant CD4⁺ Tfh response to Plasmodium infection[J]. J Exp Med, 2020, 217(2): e20190849.
[17]	Stumhofer JS, Silver JS, Hunter CA. IL-21 is required for optimal antibody production and T cell responses during chronic Toxoplasma gondii infection[J]. PLoS One, 2013, 8(5): e62889.
[18]	King IL, Mohrs M. IL-4-producing CD4⁺ T cells in reactive lymph nodes during helminth infection are T follicular helper cells[J]. J Exp Med, 2009, 206(5): 1001-1007.
[19]	Zhang YM, Wang YJ, Jiang YY, et al. T follicular helper cells in patients with acute schistosomiasis[J]. Parasit Vectors, 2016, 9(1): 321.
[20]	Yang Q, Qu JL, Jin CX, et al. Schistosoma japonicum infection promotes the response of tfh cells through down-regulation of caspase-3-mediating apoptosis[J]. Front Immunol, 2019, 10: 2154.
[21]	Chen XJ, Yang XW, Li Y, et al. Follicular helper T cells promote liver pathology in mice during Schistosoma japonicum infection[J]. PLoS Pathog, 2014, 10(5): e1004097.
[22]	Reiman RM, Thompson RW, Feng CG, et al. Interleukin-5 (IL-5) augments the progression of liver fibrosis by regulating IL-13 activity[J]. Infect Immun, 2006, 74(3): 1471-1479.
[23]	Chiaramonte MG, Donaldson DD, Cheever AW, et al. An IL-13 inhibitor blocks the development of hepatic fibrosis during a T-helper type 2-dominated inflammatory response[J]. J Clin Invest, 1999, 104(6): 777-785.
[24]	Glatman Zaretsky A, Taylor JJ, King IL, et al. T follicular helper cells differentiate from Th2 cells in response to helminth antigens[J]. J Exp Med, 2009, 206(5): 991-999.
[25]	Barron L, Wynn TA. Macrophage activation governs schistosomiasis-induced inflammation and fibrosis[J]. Eur J Immunol, 2011, 41(9): 2509-2514.
[26]	Hambrook JR, Hanington PC. Immune evasion strategies of schistosomes[J]. Front Immunol, 2021, 11: 624178.
[27]	Nagata K, Tanaka K, Ogawa K, et al. Selective expression of a novel surface molecule by human Th2 cells in vivo[J]. J Immunol, 1999, 162(3): 1278-1286.
[28]	García-Sánchez A, Estravís M, Martin MJ, et al. PTGDR2 expression in peripheral blood as a potential biomarker in adult patients with asthma[J]. J Pers Med, 2021, 11(9): 827.
[29]	Li Y, Liu SR, Zhou KW, et al. Neuromedin U programs eosinophils to promote mucosal immunity of the small intestine[J]. Science, 2023, 381(6663): 1189-1196.

基因名称 Gene name	引物序列 (5'→3') Primer sequence (5'→3')
gapdh	F：GTGGCAAAGTGGAGATTGTTG R：CGTTGAATTTGCCGTGAGTG
il5	F：TCAGGGGCTAGACATACTGAAG R：CCAAGGAACTCTTGCAGGTAAT
il13	F：CAGCCTCCCCGATACCAAAAT R：GCGAAACAGTTGCTTTGTGTAG
ptgdr2	F：TTCACTGTGTGGCTCGAGGAAG R：CCTAGAGAGCAGTTGTCAGCC
nmur1	F：CCTCGCTGTGTCCGATATGC R：GCTGGAACGGGTAATTTTGCT