Transcriptome analysis of splenic B cells in mice infected with Schistosoma japonicum

doi:10.12140/j.issn.1000-7423.2026.02.007

Abstract

Abstract:

Objective To analyze the transcriptomic characteristics of splenic B cells in mice infected with Schistosoma japonicum, screen and validate differentially expressed genes (DEGs), and provide a basis for elucidating the regulatory mechanisms of B cells during S. japonicum infection. Methods Balb/C mice were randomly divided into the control group (NC group), the 4-week post-infection group (Sj_4W group), and the 6-week post-infection group (Sj_6W group). Mice in the Sj_4W and Sj_6W groups were infected percutaneously using the patch method with (25 ± 1) S. japonicum cercariae. Mice were sacrificed at week 4 and 6 post-infection and spleen tissues were collected, respectively. Splenic B cells were isolated and enriched by magnetic bead sorting. Total RNA was extracted from splenic B cells, and transcriptome libraries were constructed. RNA sequencing was performed on the Illumina platform. Differential expression analysis was conducted using the limma and edgeR packages to screen for DEGs. Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analysis and gene ontology (GO) functional enrichment classification were performed on the DEGs. Three highly expressed genes were selected for validation by reverse transcription quantitative Real-time PCR (RT-qPCR). Results Cluster analysis revealed that a total of 6 443 DEGs were identified between the Sj_6W and NC groups, including 4 421 up-regulated genes and 2 022 down-regulated genes. A total of 6 757 DEGs were identified between the Sj_6W and Sj_4W groups, including 4 754 up-regulated genes and 2 003 down-regulated genes. GO functional enrichment analysis showed that downregulated genes were primarily involved in lymphocyte differentiation, immune response regulatory signaling pathways, and lymphocyte proliferation, whereas upregulated genes were mainly enriched in lymphocyte-mediated immunity, production of immune response molecular mediators, B cell-mediated immunity, and humoral immunity. KEGG pathway enrichment analysis revealed that downregulated genes were mainly enriched in the mitogen-activated protein kinase (MAPK) signaling pathway, Th1 and Th2 cell differentiation, and Th17 cell differentiation, whereas upregulated genes were mainly enriched in cytokine-cytokine receptor interaction, extracellular matrix-receptor interaction, and the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) signaling pathway. RT-qPCR validation confirmed that the relative mRNA expression levels of interleukin-27 (IL-27), matrix metalloproteinase-8 (MMP-8), and eosinophil protein X (EPX) in splenic B cells of the Sj_6W group were 2.14 ± 1.18, 21.86 ± 14.06, and 324.40 ± 252.40, respectively, which were significantly higher than those in the Sj_4W group (0.31 ± 0.18, 0.03 ± 0.02, and 0.44 ± 0.72; Mann-Whitney U test, P < 0.01) and also higher than those in the NC group (1.04 ± 0.29, 1.20 ± 0.72, and 1.17 ± 0.69; Mann-Whitney U test, P < 0.05). Conclusion Following S. japonicum infection, splenic B cells in mice underwent transcriptional reprogramming, with upregulated expression of IL-27, EPX, and MMP-8, accompanied by alterations in pathways related to lymphocyte differentiation and proliferation, Th1/Th2 and Th17 cell differentiation, production of immune response molecular mediators, B cell-mediated immunity and humoral immune regulation, cytokine-cytokine receptor interaction, and extracellular matrix-receptor interaction.

Key words: Schistosoma japonicum, B cells, RNA-sequencing, Transcriptome

CLC Number:

R532.21

QIU Jiayin, LI Jiajia, ZHOU Xinjie, LI Yinlong, FENG Ting, ZHENG Mao, LV Chao, QIN Zhiqiang. Transcriptome analysis of splenic B cells in mice infected with Schistosoma japonicum[J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2026, 44(2): 196-202.

Figures/Tables 5

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

References 21

[1]	Buonfrate D, Ferrari TCA, Adegnika AA, et al. Human schistosomiasis[J]. Lancet, 2025, 405(10479): 658-670.
[2]	Kuipers ME, Ozir-Fazalalikhan A, Haeberlein S, et al. Extracellular vesicles from Schistosoma mansoni adult worms stimulate IL-10 release by B cells[J]. Parasite Immunol, 2025, 47(9): e70023.
[3]	Ren JL, Zhuo Y, He FR, et al. Longitudinal immune profiling highlights CD4⁺ T cell exhaustion correlated with liver fibrosis in Schistosoma japonicum infection[J]. J Immunol, 2023, 210(1): 82-95.
[4]	Ji F, Liu ZJ, Cao JP, et al. B cell response is required for granuloma formation in the early infection of Schistosoma japonicum[J]. PLoS One, 2008, 3(3): e1724.
[5]	Osmani Z, Beudeker BJB, Groothuismink ZMA, et al. B-cell activation gene signature in blood and liver of hepatitis B e antigen-positive patients with immune active chronic hepatitis B[J]. J Infect Dis, 2024, 230(6): e1263-e1273.
[6]	Lund FE. Cytokine-producing B lymphocytes-key regulators of immunity[J]. Curr Opin Immunol, 2008, 20(3): 332-338.
[7]	Martin F, Chan AC. B cell immunobiology in disease: evolving concepts from the clinic[J]. Annu Rev Immunol, 2006, 24: 467-496.
[8]	Bod L, Kye YC, Shi JW, et al. B-cell-specific checkpoint molecules that regulate anti-tumour immunity[J]. Nature, 2023, 619(7969): 348-356.
[9]	Lundy SK, Lerman SP, Boros DL. Soluble egg antigen-stimulated T helper lymphocyte apoptosis and evidence for cell death mediated by FasL⁺T and B cells during murine Schistosoma mansoni infection[J]. Infect Immun, 2001, 69(1): 271-280.
[10]	Jankovic D, Cheever AW, Kullberg MC, et al. CD4⁺ T cell-mediated granulomatous pathology in schistosomiasis is downregulated by a B cell-dependent mechanism requiring Fc receptor signaling[J]. J Exp Med, 1998, 187(4): 619-629.
[11]	纪芳. 日本血吸虫感染及其肉芽肿病理的免疫机制研究[D]. 上海: 上海交通大学, 2007: 1-75.
	Ji F. Immunological mechanisms of Schistosoma japonicum infection and its egg granuloma pathology[D]. Shanghai: Shanghai Jiao Tong University, 2007: 1-75. (in Chinese)
[12]	Wen ZC, Ji XF, Tang JJ, et al. Positive feedback regulation between transglutaminase 2 and toll-like receptor 4 signaling in hepatic stellate cells correlates with liver fibrosis post Schistosoma japonicum infection[J]. Front Immunol, 2017, 8: 1808.
[13]	Shapouri-Moghaddam A, Mohammadian S, Vazini H, et al. Macrophage plasticity, polarization, and function in health and disease[J]. J Cell Physiol, 2018, 233(9): 6425-6440.
[14]	Wang X, Tang Q, Bergquist R, et al. The cytokine profile in different stages of schistosomiasis japonica[J]. Pathogens, 2023, 12(10): 1201.
[15]	Arthur MJP. Fibrogenesis II. Metalloproteinases and their inhibitors in liver fibrosis[J]. Am J Physiol Gastrointest Liver Physiol, 2000, 279(2): G245-G249.
[16]	Ye ZH, Huang SG, Zhang YX, et al. Galectins, eosinophiles, and macrophages may contribute to Schistosoma japonicum egg-induced immunopathology in a mouse model[J]. Front Immunol, 2020, 11: 146.
[17]	Naim A, Baig MS. Matrix metalloproteinase-8 (MMP-8) regulates the activation of hepatic stellate cells (HSCs) through the ERK-mediated pathway[J]. Mol Cell Biochem, 2020, 467(1): 107-116.
[18]	Braga TT, Correa-Costa M, Guise YFS, et al. MyD88 signaling pathway is involved in renal fibrosis by favoring a Th2 immune response and activating alternative M2 macrophages[J]. Mol Med, 2012, 18(8): 1231-1239.
[19]	Ahmadi F, Junghus F, Ashworth C, et al. cDC1-derived IL-27 regulates small intestinal CD4⁺ T cell homeostasis in mice[J]. J Exp Med, 2023, 220(3): e20221090.
[20]	Yoshimoto T, Okada K, Morishima N, et al. Induction of IgG2a class switching in B cells by IL-27[J]. J Immunol, 2004, 173(4): 2479-2485.
[21]	Lecky DAJ, Sheriff L, Rouvray ST, et al. Interferon-γ and IL-27 positively regulate type 1 regulatory T cell development during adaptive tolerance[J]. iScience, 2025, 28(5): 112308.

基因名称 Gene name	引物序列（5'→3'） Primer sequence (5'→3')
IL-27	F：CTCCCTCCCTCGCCCGTTAAG
	R：TAGTGAAGCCCTGCCTGGTCTAAG
EPX	F：CACGAACCAGCGATTCCAGGAC
	R：GCTCAGCGGCTAGGCGATTG
MMP-8	F：TGCAGAGAAGCTTAAAGAGA
	R：AGTCTCTGCTAAGCTGAAGAA