Biological functions of enolase 1 in modulation of Toxoplasma gondii tachyzoite behaviors and tachyzoite-bradyzoite transition

doi:10.12140/j.issn.1000-7423.2026.02.011

Abstract

Abstract:

Objective To investigate the specific biological functions of Toxoplasma gondii bradyzoite-specific enolase 1 (ENO1) in the tachyzoite-bradyzoite transition, and to analyze the role and molecular mechanism of the ENO family in the regulatory network of T. gondii stage transition. Methods The eno1-deleted strain ME49-Δeno1 and two complementary strains ME49-Δeno1-Comp-eno1 and ME49-Δeno1-Comp-eno2 were generated using the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (CRISPR/Cas9) gene editing technology. The growth, proliferation, and invasion of four T. gondii strains (ME49-Δku80, ME49-Δeno1, ME49-Δeno1-Comp-eno1, and ME49-Δeno1-Comp-eno2) were evaluated following infections in human foreskin fibroblast cells with the plaque assay, proliferation assay, and invasion assay, respectively. The relative transcriptional levels of tachyzoite-specific surface antigen 1 (sag1) and bradyzoite-specific antigen 1 (bag1) genes were quantified in ME49-Δku80 and ME49-Δeno1 strains using quantitative Real-time PCR (qPCR) assay under in vitro alkaline induction to evaluate the effect of eno1 deletion on the ability of T. gondii tachyzoites transition to bradyzoites, and the synthesis of nascent peptide chains was detected in ME49-Δku80 and ME49-Δeno1 strains using puromycin labeling and Western blotting assay to examine the effect of eno1 deletion on the synthesis of T. gondii proteins. Results The eno1-deleted strain ME49-Δeno1 and its two complementary strains ME49-Δeno1-Comp-eno1 and ME49-Δeno1-Comp-eno2 were successfully generated. Plaque, proliferation, and invasion assays showed that the areas of plaques were (16 538 ± 14 310), (4 376 ± 5 355), (17 377 ± 14 333), and (8 710 ± 8 207) μm², and the average numbers of parasites per parasitophorous vacuole were (5.836 ± 0.382), (4.792 ± 0.150), (5.165 ± 1.243), and (3.872 ± 0.301) in ME49-Δku80, ME49-Δeno1, ME49-Δeno1-Comp-eno1, and ME49-Δeno1-Comp-eno2 strains, while the invasion efficiencies of ME49-Δku80, ME49-Δeno1, ME49-Δeno1-Comp-eno1, and ME49-Δeno1-Comp-eno2 strains were (57.802 ± 6.932)%, (19.679 ± 4.508)%, (63.833 ± 1.198)%, and (35.901 ± 8.098)%, respectively, indicating that deletion of eno1 inhibited the growth (F = 38.290, P < 0.01), intracellular proliferation (F = 4.467, P < 0.05), and invasion ability (F = 36.650, P < 0.01) of T. gondii. Complementation of eno1 fully restored these abilities, and there were no significant differences between ME49-Δeno1-Comp-eno1 and ME49-Δku80 in terms of the plaque areas (t = 0.459, P > 0.05), average number of T. gondii tachyzoites per parasitophorous vacuole (t = 0.895, P > 0.05), or invasion efficiency (t = 1.485, P > 0.05). Nevertheless, complementation of eno2 partially restored the growth, proliferation and invasion abilities of T. gondii. The area of plaques generated by the ME49-Δeno1-Comp-eno2 strain was larger than that by the ME49-Δeno1 strain (t = 5.263, P < 0.05), but smaller than that by the ME49-Δku80 strain (t = 4.905, P < 0.01), and the average number of tachyzoites per parasitophorous vacuole was lower in the ME49-Δeno1-Comp-eno2 strain than in the ME49-Δku80 strain (t = 6.998, P < 0.05), while the invasion efficiency of the ME49-Δeno1-Comp-eno2 strain was higher than that of the ME49-Δeno1 strain (t = 3.032, P < 0.05) but lower than that of the ME49-Δku80 strain (t = 3.559, P < 0.05). Following alkaline induction for 48 h, there was no significant difference in the relative transcriptional level of sag1 gene between the ME49-Δeno1 strain (1.067 ± 0.115) and the ME49-Δku80 strain (1.002 ± 0.154) (t = 0.584, P > 0.05), and the relative transcriptional level of bag1 gene was lower in the ME49-Δeno1 strain (13.172 ± 1.679) than in the ME49-Δku80 strain (20.338 ± 1.344) (t = 5.770, P < 0.01). Following alkaline induction for 96 h, the relative transcriptional level of sag1 gene was higher in the ME49-Δeno1 strain (0.957 ± 0.132) than in the ME49-Δku80 strain (0.727 ± 0.053) (t = 2.803, P < 0.05), and the relative transcriptional level of bag1 gene was lower in the ME49-Δeno1 strain (162.248 ± 23.377) than in the ME49-Δku80 strain (231.413 ± 12.910) (t = 4.486, P < 0.05). Western blotting assay detected no significant difference in the level of nascent peptide synthesis between the ME49-Δku80 and ME49-Δeno1 strain, indicating no significant effect of eno1 deletion on the synthesis ability of T. gondii proteins. Conclusion Bradyzoite-specific enolase eno1 promotes the growth of T. gondii tachyzoites and positively regulates the transition from tachyzoites to bradyzoites. It is a key regulator but not compulsory in the T. gondii tachyzoite-bradyzoite transition. In addition, ENO1 cannot be functionally replaced by ENO2 in the proliferation of T. gondii tachyzoites.

Key words: Toxoplasma gondii, Enolase 1, Enolase 2, Glycolysis, Tachyzoite-bradyzoite interconversion

CLC Number:

R382.5

ZHU Di, WU Weiling, KONG Dehao, ZHOU Zhihao, PENG Hongjuan. Biological functions of enolase 1 in modulation of Toxoplasma gondii tachyzoite behaviors and tachyzoite-bradyzoite transition[J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2026, 44(2): 222-228.

Figures/Tables 6

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

References 18

[1]	Lunghi M, Galizi R, Magini A, et al. Expression of the glycolytic enzymes enolase and lactate dehydrogenase during the early phase of Toxoplasma differentiation is regulated by an intron retention mechanism[J]. Mol Microbiol, 2015, 96(6): 1159-1175.
[2]	Ashry NI, El Shewehy DMM, Elbadry DA, et al. Protective effect of S-methylcysteine against Toxoplasma gondii-induced reproductive toxicity in female albino rats[J]. Acta Parasitol, 2025, 71(1): 1.
[3]	Xia J, Fu Y, Huang WY, et al. Constitutive upregulation of transcription factors underlies permissive bradyzoite differentiation in a natural isolate of Toxoplasma gondii[J]. mBio, 2024, 15(9): e0064124.
[4]	Yang Y, Zhou CC, Yang CL, et al. Gut microbiota-associated metabolite N-acetyl-D-glucosamine alleviates systemic inflammatory responses induced by acute Toxoplasma gondii infection[J]. PLoS Negl Trop Dis, 2026, 20(3): e0014108.
[5]	Magoye E, Schmid MW, Ramakrishnan C, et al. Genome-wide transcriptomic analysis of Toxoplasma gondii reveals stage-specific regulatory programs and metabolic adaptations driving oocyst sporulation[J]. BMC Genomics, 2026, 27(1): 345.
[6]	Sokol-Borrelli SL, Reilly SM, Holmes MJ, et al. A transcriptional network required for bradyzoite development in Toxoplasma gondii is dispensable for recrudescent disease[J]. Nat Commun, 2023, 14(1): 6078.
[7]	Ma ZR, Mutashar Alhameed AM, Kaminga AC, et al. Bioinformatics of excretory/secretory proteins of Toxoplasma gondii strain ME49[J]. Microb Pathog, 2020, 140: 103951.
[8]	Ferguson DJ, Parmley SF, Tomavo S. Evidence for nuclear localisation of two stage-specific isoenzymes of enolase in Toxoplasma gondii correlates with active parasite replication[J]. Int J Parasitol, 2002, 32(11): 1399-1410.
[9]	Jiang W, Xue JX, Liu YC, et al. Identification and characterization of an immunogenic antigen, enolase 2, among excretory/secretory antigens (ESA) of Toxoplasma gondii[J]. Protein Expr Purif, 2016, 127: 88-97.
[10]	Ferguson DJ. Use of molecular and ultrastructural markers to evaluate stage conversion of Toxoplasma gondii in both the intermediate and definitive host[J]. Int J Parasitol, 2004, 34(3): 347-360.
[11]	Mouveaux T, Oria G, Werkmeister E, et al. Nuclear glycolytic enzyme enolase of Toxoplasma gondii functions as a transcriptional regulator[J]. PLoS One, 2014, 9(8): e105820.
[12]	Kibe MK, Coppin A, Dendouga N, et al. Transcriptional regulation of two stage-specifically expressed genes in the protozoan parasite Toxoplasma gondii[J]. Nucleic Acids Res, 2005, 33(5): 1722-1736.
[13]	Dzierszinski F, Mortuaire M, Dendouga N, et al. Differential expression of two plant-like enolases with distinct enzymatic and antigenic properties during stage conversion of the protozoan parasite Toxoplasma gondii[J]. J Mol Bio, 2001, 309(5): 1017-1027.
[14]	Liu Y, Hou YY, Zhang F, et al. ENO1 deletion potentiates ferroptosis and decreases glycolysis in colorectal cancer cells via AKT/STAT3 signaling[J]. Exp Ther Med, 2024, 27(4): 127.
[15]	Zhang LH, Lu T, Yang Y, et al. α-enolase is highly expressed in liver cancer and promotes cancer cell invasion and metastasis[J]. Oncol Lett, 2020, 20(5): 152.
[16]	Song LM, Ma SR, Wang SB, et al. ENO1 knockdown impedes tumour progression and promotes oxidative phosphorylation in cutaneous squamous cell carcinoma[J]. Acta Derm Venereol, 2025, 105: adv43849.
[17]	Manger ID, Hehl A, Parmley S, et al. Expressed sequence tag analysis of the bradyzoite stage of Toxoplasma gondii: identification of developmentally regulated genes[J]. Infect Immun, 1998, 66(4): 1632-1637.
[18]	Ruan J, Mouveaux T, Light SH, et al. The structure of bradyzoite-specific enolase from Toxoplasma gondii reveals insights into its dual cytoplasmic and nuclear functions[J]. Acta Crystallogr D Biol Crystallogr, 2015, 71(Pt 3): 417-426.

引物名称 Primer name	引物序列（5′→3′） Primer sequence (5′→3′)	扩增长度/bp Amplication length/bp
eno1-P1-F	CAAGTTTGTTGTAAGCCTCG	800
eno1-P1-R	CATGCCGATGCCAAGGGCG
eno1-P2-F	CATCATGTATCAGCGGTCGTG	1 000
eno1-P2-R	CAAGCGCCATTCCCACTG
eno1-P3-F	CAGAGGCAATCGAAGCGTGC	600
eno1-P3-R	CAAGCGCCATTCCCACTG
comp-eno1/eno2-P1-F	GGTTGATTCGAGCAACTTACAAG	1 000
comp-eno1-P1-R	CCACTAGGAACCGCAGCTC
comp-eno2-P1-R	CGTAGATGCCAGTGGATGCG
comp-eno1-P2-F	CTCTGTAACAGAGGCAATCGAAG	800
comp-eno2-P2-F	CACAGTCAGCGAGTCTATCGAG
comp-eno1/eno2-P2-R	CTCTTGAGGCGTGCTTCTTC
comp-eno1/eno2-P3-F	GGTTGATTCGAGCAACTTACAAG	600
comp-eno1/eno2-P3-R	CTCGTGATGATGTCCTGGAGAATG