Immunoprotective effect of exosomes derived from Plasmodium-infected red blood cells on experimental cerebral malaria

doi:10.12140/j.issn.1000-7423.2026.03.010

Abstract

Abstract:

Objective To explore the immunoprotective effect and mechanism of exosomes derived from Plasmodium-infected red blood cells on experimental cerebral malaria (ECM) in mice. Methods Exosomes were extracted and identified from peripheral blood of BALB/c mice infected with Plasmodium yoelii 17XNL (P.y17XNL). C57BL/6J mice were randomly divided into ECM group, exosome immunization group (Exos + ECM group) and negative control group (NC group). Mice in the Exos + ECM group received two doses of exosome immunization via tail vein injection; 20 days after immunization, mice in the ECM group and Exos + ECM group were intraperitoneally injected with 1 × 10⁶ P. berghei ANKA (P.bANKA)-infected red blood cells, while mice in the NC group were intraperitoneally injected with an equal volume of normal saline. The erythrocyte infection rate and mice survival rate were dynamically observed. Mice brain tissues were collected, and the absorbance at 630 nm (A₆₃₀ value) of the supernatant was detected after Evans blue perfusion to evaluate the integrity of the blood-brain barrier in mice. Hematoxylin-eosin (HE) staining was used to observe the pathological changes of mice brain tissue, and immunohistochemical staining was performed to detect the expression of intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) in brain microvessels. Western blotting and real-time fluorescent quantitative reverse transcription PCR (qRT-PCR) were used to detect the changes of inflammation-related cytokines in mice brain tissue. Proteomics analysis was combined to explore the regulatory association between core differential components of exosomes and brain tissue inflammatory factors. Results The erythrocyte infection rates of the ECM group and Exos + ECM group reached the peak on day 11 and day 15 post-infection, with values of (25.0 ± 0.0)% and (17.2 ± 4.4)%, respectively, and the erythrocyte infection rate in the Exos + ECM group increased more slowly. All mice in the ECM group died of cerebral malaria on day 13 post-infection, and the survival rate of mice in the Exos + ECM group was 83.3% on day 15 post-infection. The detection results of blood-brain barrier integrity showed that the blood-brain barrier in the ECM group was damaged, while the damage in the Exos + ECM group was not obvious. the A₆₃₀ values of the supernatant in the NC group and Exos + ECM group were (0.28 ± 0.04) and (0.62 ± 0.01) respectively, both lower than (0.89 ± 0.02) in the ECM group (t = 24.24, 10.53, both P < 0.01). The results of HE staining and immunohistochemistry of brain tissue showed that, compared with the ECM group, the number of infected red blood cells in brain microvessels, inflammatory infiltration, and the expression levels of ICAM-1 and VCAM-1 in the Exos + ECM group were reduced. The qRT-PCR results showed that the relative mRNA transcription levels of ICAM-1, VCAM-1, interleukin-6 (IL-6), IL-17A, transforming growth factor-β (TGF-β) and IL-10 in the brain of Exos + ECM group mice were 4.05 ± 0.42, 1.24 ± 0.14, 0.48 ± 0.3, 0.27 ± 0.31, 1.39 ± 0.53 and 4.23 ± 3.29, respectively, which were lower than 8.11 ± 0.86, 2.80 ± 0.33, 1.38 ± 0.76, 2.28 ± 0.26, 2.94 ± 0.49 and 16.02 ± 3.56 in the ECM group (t = 8.76, 8.52, 2.91, 6.81, 4.51, 5.41, P < 0.01, 0.01, 0.05, 0.01, 0.05, 0.01). Western blotting results showed that the protein expression levels of Toll-like receptor 4 (TLR4), IL-1β and tumor necrosis factor-α (TNF-α) in the brain of Exos + ECM group mice were 0.84 ± 0.06, 0.81 ± 0.04 and 2.07 ± 0.72, respectively, which were lower than 1.24 ± 0.04, 0.85 ± 0.03 and 6.06 ± 2.45 in the ECM group (t = 7.07, 1.27, 3.12, all P < 0.05). Proteomics results showed that the differential proteins of exosomes from P.y17XNL-infected mice and normal mice were mainly enriched in nuclear proteins, cytoplasmic proteins, plasma membrane proteins and mitochondrial proteins, which were related to protein export, transport and amino acid metabolism. Conclusion Exosome immunization had an immunoprotective effect on ECM, which can reduce the erythrocyte infection rate and improve the survival rate of mice. The main mechanism may be related to reducing brain inflammation, protecting the integrity of the blood-brain barrier and improving the pathological damage of mice brain tissue.

Key words: Plasmodium yoelii 17XNL, Exosomes, Plasmodium berghei ANKA, Experimental cerebral malaria, Blood-brain barrier

CLC Number:

R531.3

XU Bin, SONG Liguo, WANG Hongxuan, SHAN Ting, BAO Bowen, LIU Shuangchun, DU Yunting, CHEN Guang. Immunoprotective effect of exosomes derived from Plasmodium-infected red blood cells on experimental cerebral malaria[J]. CHINESE JOURNAL OF PARASITOLOGY AND PARASITIC DISEASES, 2026, 44(3): 378-387.

Figures/Tables 10

Table 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

Fig. 8

Fig. 9

References 30

[1]	World Health Organization. World malaria report 2024: addressing inequity in the global malaria response[R]. Geneva: WHO, 2024: 6-9.
[2]	Luzolo AL, Ngoyi DM. Cerebral malaria[J]. Brain Res Bull, 2019, 145: 53-58.
[3]	Birbeck GL, Molyneux ME, Kaplan PW, et al. Blantyre Malaria Project Epilepsy Study (BMPES) of neurological outcomes in retinopathy-positive paediatric cerebral malaria survivors: a prospective cohort study[J]. Lancet Neurol, 2010, 9(12): 1173-1181.
[4]	Duffy PE. Current approaches to malaria vaccines[J]. Curr Opin Microbiol, 2022, 70: 102227.
[5]	Stanisic DI, Good MF. Malaria vaccines: progress to date[J]. BioDrugs, 2023, 37(6): 737-756.
[6]	Feng GQ, Kurtovic L, Agius PA, et al. Induction, decay, and determinants of functional antibodies following vaccination with the RTS,S malaria vaccine in young children[J]. BMC Med, 2022, 20(1): 289.
[7]	Chen JG, Liu SC, Nie Q, et al. Exosome-derived long noncoding RNAs: mediators of host-Plasmodium parasite communication[J]. Wiley Interdiscip Rev RNA, 2023: e1808.
[8]	Chen JG, Du YT, Guan CH, et al. Extracellular vesicles derived from Plasmodium-infected hosts as stimuli of “trained” innate immunity[J]. CMC, 2023, 30(39): 4450-4465.
[9]	Lv YY, Wu S, Nie Q, et al. Extracellular vesicles derived from Plasmodium-infected red blood cells alleviate cerebral malaria in Plasmodium berghei ANKA-infected C57BL/6J mice[J]. Int Immunopharmacol, 2024, 132: 111982.
[10]	Rehman FU, Liu Y, Zheng M, et al. Exosomes based strategies for brain drug delivery[J]. Biomaterials, 2023, 293: 121949.
[11]	Picca A, Guerra F, Calvani R, et al. Circulating extracellular vesicles: friends and foes in neurodegeneration[J]. Neural Regen Res, 2022, 17(3): 534-542.
[12]	Long XB, Yao XL, Jiang Q, et al. Astrocyte-derived exosomes enriched with miR-873a-5p inhibit neuroinflammation via microglia phenotype modulation after traumatic brain injury[J]. J Neuroinflammation, 2020, 17(1): 89.
[13]	Elieh-Ali-Komi D, Shafaghat F, Alipoor SD, et al. Immunomodulatory significance of mast cell exosomes (MC-EXOs) in immune response coordination[J]. Clin Rev Allergy Immunol, 2025, 68(1): 20.
[14]	Martin-Jaular L, Nakayasu ES, Ferrer M, et al. Exosomes from Plasmodium yoelii-infected reticulocytes protect mice from lethal infections[J]. PLoS One, 2011, 6(10): e26588.
[15]	Rangel-Ramírez VV, González-Sánchez HM, Lucio-García C. Exosomes: from biology to immunotherapy in infectious diseases[J]. Infect Dis (Lond), 2023, 55(2): 79-107.
[16]	Ghazanfari N, Mueller SN, Heath WR. Cerebral malaria in mouse and man[J]. Front Immunol, 2018, 9: 2016.
[17]	Bashyal S, Thapa C, Lee S. Recent progresses in exosome-based systems for targeted drug delivery to the brain[J]. J Control Release, 2022, 348: 723-744. 704-713
[18]	Eichenberger RM, Sotillo J, Loukas A. Immunobiology of para sitic worm extracellular vesicles[J]. Immunol Cell Biol, 2018: 704-713.
[19]	Alloo J, Leleu I, Grangette C, et al. Parasite infections, neuroinflammation, and potential contributions of gut microbiota[J]. Front Immunol, 2022, 13: 1024998.
[20]	Pais TF, Ali H, Moreira da Silva J, et al. Brain endothelial STING1 activation by Plasmodium-sequestered heme promotes cerebral malaria via type I IFN response[J]. Proc Natl Acad Sci U S A, 2022, 119(36): e2206327119.
[21]	Ramachandran A, Sharma A. Dissecting the mechanisms of pathogenesis in cerebral malaria[J]. PLoS Pathog, 2022, 18(11): e1010919.
[22]	Willimann K, Matile H, Weiss NA, et al. In vivo sequestration of Plasmodium falciparum-infected human erythrocytes: a severe combined immunodeficiency mouse model for cerebral malaria[J]. J Exp Med, 1995, 182(3): 643-653.
[23]	Yipp BG, Anand S, Schollaardt T, et al. Synergism of multiple adhesion molecules in mediating cytoadherence of Plasmodium falciparum-infected erythrocytes to microvascular endothelial cells under flow[J]. Blood, 2000, 96(6): 2292-2298.
[24]	Nagamine Y, Hayano M, Kashiwamura SI, et al. Involvement of interleukin-18 in severe Plasmodium falciparum malaria[J]. Trans R Soc Trop Med Hyg, 2003, 97(2): 236-241.
[25]	Xu Lou I, Zhou HF, Wan HT. The critical role of Th17 cells and IL-17A in autoimmune and inflammation-associated neurological diseases: mechanisms and therapeutic perspectives[J]. Front Immunol, 2025, 16: 1656422.
[26]	Wu S, Nie Q, Tan S, et al. The immunity modulation of transforming growth factor-β in malaria and other pathological process[J]. Int Immunopharmacol, 2023, 122: 110658.
[27]	Islam R, Vrionis F, Hanafy KA. Microglial TLR4 is critical for neuronal injury and cognitive dysfunction in subarachnoid hemorrhage[J]. Neurocrit Care, 2022, 37(3): 761-769.
[28]	Hu ZQ, Ma RJ, Sun JQ, et al. Tenascin-C facilitates microglial polarization via TLR4/MyD88/NF-κB pathway following subarachnoid hemorrhage[J]. J Inflamm Res, 2025, 18: 3555-3570.
[29]	Tripathi AK, Sullivan DJ, Stins MF. Plasmodium falciparum-infected erythrocytes increase intercellular adhesion molecule 1 expression on brain endothelium through NF-kappaB[J]. Infect Immun, 2006, 74(6): 3262-3270.
[30]	Zhang J, Li Q, Zou YR, et al. HMGB1-TLR4-IL-23-IL-17A axis accelerates renal ischemia-reperfusion injury via the recruitment and migration of neutrophils[J]. Int Immunopharmacol, 2021, 94: 107433.

名称 Name	序列（5′→3′） Sequences（5′→3′）
ICAM-1	F：AGTCGTCCGCTTCCGCTACC
ICAM-1	R：AGGGTGAGGTCCTTGCCTACTTG
VCAM-1	F：GCTTCAAGAGGGTGGTGCTGTG
VCAM-1	R：GCAATTAAGGTGAGGGTGGCATTTC
IL-12b	F：CATTGAACTGGCGTTGGAAGCAC
IL-12b	R：GGGCGGGTCTGGTTTGATGATG
TNF-α	F：CACCACGCTCTTCTGTCTACTGAAC
TNF-α	R：TGACGGCAGAGAGGAGGTTGAC
IL-18	F：GTTAGGTGGGGAGGGTTTGTGTTC
IL-18	R：GCAGCCTCGGGTATTCTGTTATGG
IFN-γ	F：AGCCTTCTGCTTCTGCTG
IFN-γ	R：TCTGCTGCTGCTGCTGCT
IL-17A	F：TGATGCTGTTGCTGCTGCTGAG
IL-17A	R：GGTCTTCATTGCGGTGGAGAGTC
TGF-β	F：ACCGCAACAACGCCATCTATGAG
TGF-β	R：AGCCCTGTATTCCGTCTCCTTGG
IL-10	F：GGACAACATACTGCTAACCGACTCC
IL-10	R：CTTCACCTGCTCCACTGCCTTG
ACTB	F：CCTGGCACCCAGCACAAT